Reaction | Reacting groups | Substrates | Product | Metal ion | Seq description |
---|---|---|---|---|---|
Thymine dimer repair |
Group 1 - 2'-OH Group 2 - vicinal phosphate |
X: T=T is a thymine dimer S: AGGATCTACATGTAT=TGTGTGCGTACGAGTATATG |
repaired sequences |
light Na+ K+ |
N * |
Buffer conditions |
---|
20 mM Sodium phosphate pH 7.0, 240 mM NaCl |
kcat/ kobs |
---|
kcat = 4.5 min-1 |
Catalytic region of the DNAzyme |
---|
GGAGAACGCGAGGCAAGGCTGGGAGAAATGTGGATCACGATT |
Notes |
---|
Fragment of UV1A, trans-acting |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2004 | D J-F Chinnapen | D Sen | A deoxyribozyme that harnesses light to repair thymine dimers in DNA. | 14691255 | 10.1073/pnas.0305943101 | Thymine dimer repair |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2007 | D J-F Chinnapen | D Sen | Towards elucidation of the mechanism of UV1C, a deoxyribozyme with photolyase activity. | 17141270 | 10.1016/j.jmb.2006.10.062 |
Thymine dimer repair |
2009 | G S Sekhon | D Sen | Unusual DNA-DNA cross-links between a photolyase deoxyribozyme, UV1C, and its bound oligonucleotide substrate. | 19514779 | 10.1021/bi900531z |
Thymine dimer repair |
2016 | A Barlev | D Sen | DNA Repair by DNA: The UV1C DNAzyme Catalyzes Photoreactivation of Cyclobutane Thymine Dimers in DNA More Effectively than Their de Novo Formation. | 27726378 | 10.1021/acs.biochem.6b00951 |
Thymine dimer repair |
2018 | A Barlev | D Sen | DNA's Encounter with Ultraviolet Light: An Instinct for Self-Preservation? | 29419284 | 10.1021/acs.accounts.7b00582 |
Thymine dimer repair |
2009 | R E Thorne | D Sen | A deoxyribozyme, Sero1C, uses light and serotonin to repair diverse pyrimidine dimers in DNA. | 19281822 | 10.1016/j.jmb.2009.02.064 |
Thymine dimer repair |