DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion  Seq description
Thymine dimer repair Group 1 - 2'-OH

Group 2 - vicinal phosphate

X: T=T is a thymine dimer
S: AGGATCTACATGTAT=TGTGTGCGTACGAGTATATG
repaired sequences light
N 40
 Buffer conditions
20 mM Sodium phosphate pH 7.0, 40 mM NaCl, 10 μM Serotonin
 Catalytic region of the DNAzyme
AGGATCTACATGTAT=TGTGTGCGTACGAGTATATGGAGAACGCGAGGCAAGGCTGGGAGAAATGTGGATCACGATTGTCTCAATCGGTCTGTATC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2004 D J-F Chinnapen D Sen A deoxyribozyme that harnesses light to repair thymine dimers in DNA. 14691255 10.1073/pnas.0305943101 Thymine dimer repair

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra