DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion  Seq description
RNA cleavage Group 1 - 2'-OH

Group 2 - vicinal phosphate

X: F = fluorescein-dT, Q = DABCYL-dT
S: GATGTGTCCGTGCFrAQGGTTCGA
cleavage of single ribonucleotide phosphodiester Mn2+
N 70
 Buffer conditions
400 mM NaCl, 100 mM KCl, 8.5 mM MgCl2, 5 mM MnCl2, 1.25 mM CdCl2, 0.25 mM NiCl2, citrate pH 5.0
 kcat/ kobs
kobs = 0.72 min-1
 Catalytic region of the DNAzyme
TGAATAGGGTCTCGGGCATAAATTACGGAAACGGTTTTAATTTTCTAGTGGAAAGGTCCGATAACGAGGT
Notes
Evolved from a population initially selected at pH 4.0. Also appeared in pH3 and pH4 pools as pH3DZ10 and pH4DZ2

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2003 Z Liu Y Li Assemblage of signaling DNA enzymes with intriguing metal-ion specificities and pH dependences. 12812493 10.1021/ja035208+ RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra