DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion  Seq description
DNA phosphorylation Group 1 - GTP

Group 2 - 5'-OH

S: GGAAGAGATGCGAC-N70-AGCTGATCCTGATGG
5'-self phosphorylated DNA Mn2+
N 70
 Buffer conditions
50 mM HEPES pH 7.0, 400 mM NaCl, 100 mM KCl, 15 mM MnCl2, 1 mM ATP, 1 mM GTP
 Catalytic region of the DNAzyme
TATCTGCAGGGATTTGGGAAGCAGGCTTAACTGGGGGAGGTTCAGAAACTAGGCGGCGTAGGGACGTAC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2002 W Wang Y Li Sequence diversity, metal specificity, and catalytic proficiency of metal-dependent phosphorylating DNA enzymes. 11983339 10.1016/S1074-5521(02)00127-8 DNA phosphorylation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra