Reaction | Reacting groups | Substrates | Product | Metal ion | Seq description |
---|---|---|---|---|---|
DNA phosphorylation |
Group 1 - GTP Group 2 - 5'-OH |
S: GGAAGAGATGGCGAT-N70-AGCTGATCCTGATGG |
5'-self phosphorylated DNA |
Cu2+ |
N 70 |
Buffer conditions |
---|
50 mM HEPES pH 7.0, 400 mM NaCl, 100 mM KCl, 15 mM MgCl2, 50 μM CuCl2, 1 mM ATP, 1 mM GTP |
Catalytic region of the DNAzyme |
---|
GGTGGTCATCGCGGGACACGCGCTGTCGGTTTGGGCGCTCAGGGATTAGTGTCGAAGCGTACTGTGTAG |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2002 | W Wang | Y Li | Sequence diversity, metal specificity, and catalytic proficiency of metal-dependent phosphorylating DNA enzymes. | 11983339 | 10.1016/S1074-5521(02)00127-8 | DNA phosphorylation |