| Reaction | Reacting groups | Substrates | Product | Porphyrin metalation |
Group 1 - 2'-OH Group 2 - vicinal phosphate |
S: mesoporphyrin IX (MPIX) |
Cu-MPIX or Zn-MPIX |
|---|
| Buffer conditions |
|---|
| 100 mM Tris pH 7.4, 200 mM NaOAc, 25 mM KOAc, 10 mM Mg(OAc)2, 5% DMSO, 0.5% Triton X-100, 1 mM Cu(OAc)2 or Zn(OAc)2 |
| kcat/ kobs |
|---|
| kcat = 13.7 h-1 |
| Catalytic region of the DNAzyme |
|---|
| TCGTGGGTCATTGTGGGTGGGTGTGGCTGGTCC |
| Notes |
|---|
| The related publication by Li Y and Sen D (1997) reports an extensive characterization of the previously reported porphyrin metalating PS5.ST1, including additional substrates (MPIX, PPIX, and DPIX) and optimized DNAzyme sequences. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 1996 | Y Li | D Sen | A catalytic DNA for porphyrin metallation | None | 10.1038/nsb0996-743 | Porphyrin metalation |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 1997 | Y Li | D Sen | Toward an efficient DNAzyme. | 9154943 | 10.1021/bi962694n |
Porphyrin metalation |