| Reaction | Reacting groups | Substrates | Product | Metal ion | Seq description | RNA cleavage |
Group 1 - 2'-OH Group 2 - vicinal phosphate |
S: CGACTCACTATrAGGAAGAGATG |
cleavage of single ribonucleotide phosphodiester |
Histidine |
N 39 |
|---|
| Buffer conditions |
|---|
| 50 mM L-Histidine (pH 7.5), 0.5 M NaCl, 0.5 M KCl, 0.5 mM EDTA |
| Catalytic region of the DNAzyme |
|---|
| GCAGTTGGGTCTGGTTGGGTAGGAAGTTAATGTGAGACG |
| Notes |
|---|
| Reselected from a mutagenized pool based on class II |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 1998 | A Roth | R R Breaker | An amino acid as a cofactor for a catalytic polynucleotide. | 9600911 | 10.1073/pnas.95.11.6027 | RNA cleavage |