DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Seq description
RNA cleavage Group 1 - 2'-OH

Group 2 - vicinal phosphate

S: CGACTCACTATrAGGAAGAGATG
cleavage of single ribonucleotide phosphodiester N 40
 Buffer conditions
50 mM L-Histidine (pH 7.5), 0.5 M NaCl, 0.5 M KCl, 0.5 mM EDTA
 Catalytic region of the DNAzyme
AGGATTAAGCCGAATTCCAGCACACTGGCGGCCGCTTCAC
Notes
The substrate is part of a biotin-modified DNA, designed to be immobilized on a streptavidin-derivatized column matrix in the in vitro selection.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
1998 A Roth R R Breaker An amino acid as a cofactor for a catalytic polynucleotide. 9600911 10.1073/pnas.95.11.6027 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra