Reaction | Reacting groups | Substrates | Product | Seq description |
---|---|---|---|---|
RNA cleavage |
Group 1 - 2'-OH Group 2 - vicinal phosphate |
S: CGACTCACTATrAGGAAGAGATG |
cleavage of single ribonucleotide phosphodiester | N 40 |
Buffer conditions |
---|
50 mM L-Histidine (pH 7.5), 0.5 M NaCl, 0.5 M KCl, 0.5 mM EDTA |
Catalytic region of the DNAzyme |
---|
GTTGGGTCACGGTATGGGGTCACTCGACGAAAATGCCGG |
Notes |
---|
The substrate is part of a biotin-modified DNA, designed to be immobilized on a streptavidin-derivatized column matrix in the in vitro selection. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
1998 | A Roth | R R Breaker | An amino acid as a cofactor for a catalytic polynucleotide. | 9600911 | 10.1073/pnas.95.11.6027 | RNA cleavage |