DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH

Group 2 - vicinal phosphate

S: AUAGACUGAAUGAAGGACUUCCGUAACU
cleavage after G16 Mg2+
RNA phosphodiester N 20
 Buffer conditions
50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2
 Catalytic region of the DNAzyme
GGTCTCGCGGGTCCTGGCTC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2018 M V Sednev C Höbartner N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes. 30276938 10.1002/anie.201808745 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra