| Reaction | Reacting groups | Substrates | Product | Metal ion | Seq description | DNA depurination |
Group 1 - periodate Group 2 - G1 |
S: GGAAGAGATGGCGACGGCGAACTCTTC-N70-AGCTGATCCTGATGG |
depurinated 10FN10 at position 1 |
IO4- |
N 70 |
|---|
| Buffer conditions |
|---|
| 2 mM UDP-GlcNAc, 60 mM MOPS pH 7.0, 150 mM NaCl, 50 mM KCl, 10 mM MgCl2, 10 mM CaCl2, 500 µM ZnCl2, 50 µM CuCl2, 50 µM CoCl2 |
| Catalytic region of the DNAzyme |
|---|
| TAGCTATCCGGTACTAAGGGGCCTGACTCATTAGACCCACACACGGTACCCTTTGACTACCTTCGTCCCG |
| Notes |
|---|
| Consult the reference for detailed explanation of the sequence composition of 10FN10 and the in vitro selection procedure. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2007 | C Höbartner | S K Silverman | Site-selective depurination by a periodate-dependent deoxyribozyme. | 17534508 | 10.1039/b704507g | DNA depurination |