DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - internal 2'-OH

Group 2 - 5'-triphosphate

L: GGATAATACGXTTCACTGCG
R: GGAAGAGAUGGCGACGG
X: rA, rC
branched RNA Mg2+
branch-site nucleotide X N *
 Buffer conditions
50 mm CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2
 Yield (%) kcat/ kobs
61 kobs = 0.0094 min-1
 Catalytic region of the DNAzyme
CAGCTATATGTGCTGGACTGAGAGGGGTAGTTTCGCAGTGAGGTGTAGG
Notes
Pool N33-CGCAGTGAG-N7, the deoxyribozyme's sequence is anotated with the 9-nt linker between the two initially randomized regions

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2008 P I Pradeepkumar Scott K Silverman DNA-catalyzed formation of nucleopeptide linkages. 18214866 10.1002/anie.200703676 RNA ligation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra