| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | Covalent Modification of Amino Acid Side Chains |
Group 1 - Ser Group 2 - 5'-triphosphate |
L: DNA-C3-CSA tripeptide R: GGAAGAGAUGGCGACGG |
nucleopeptide linkage |
Mn2+ Mg2+ |
Ser-RNA | N 40 |
|---|
| Buffer conditions |
|---|
| 50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2 |
| Yield (%) | kcat/ kobs |
|---|---|
| 65 | kobs = 0.50 h-1 |
| Catalytic region of the DNAzyme |
|---|
| CAAGGAGAGTTGTACAAGCTCGGGTCGTGTTCAAAGGGATC |
| Notes |
|---|
| Strong activity with DNA-C<sub>3</sub>-CYA, DNA-HEG-CYA and free CYA substrates |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2011 | O Y Wong | S K Silverman | DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates. | 21510668 | 10.1021/bi200585n | Covalent Modification of Amino Acid Side Chains |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2013 | J Chandrasekar | S K Silverman | Catalytic DNA with phosphatase activity. | 23509279 | 10.1073/pnas.1221946110 |
Dephosphorylation |