DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
Covalent Modification of Amino Acid Side Chains Group 1 - Tyr

Group 2 - 5'-triphosphate

L: DNA-C3-CYA tripeptide
R: GGAAGAGAUGGCGACGG
nucleopeptide linkage Mn2+
Mg2+
Tyr-RNA N 40
 Buffer conditions
50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2
 Yield (%) kcat/ kobs
77 kobs = 5.6 h-1
 Catalytic region of the DNAzyme
CAAGGAGTGCTGGAGAGGCACGGGTCGTGGCAAAAGTGTC
Notes
Evolved from 10KC3

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2011 O Y Wong S K Silverman DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates. 21510668 10.1021/bi200585n Covalent Modification of Amino Acid Side Chains

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra