Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | Covalent Modification of Amino Acid Side Chains |
Group 1 - Tyr Group 2 - 5'-triphosphate |
L: DNA anchor-C3-CXA tripeptide R: GGAAGAGAUGGCGACGG X: Tyrosine or Serine |
nucleopeptide linkage |
Mn2+ Mg2+ |
Tyr-RNA | N 40 |
---|
Buffer conditions |
---|
50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2 |
Yield (%) | kcat/ kobs |
---|---|
70 | kobs = 0.28 h-1 |
Catalytic region of the DNAzyme |
---|
CAAGGAGCGTTGGACAAGCGCGGGTCGTTCCAAAAGTAGG |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2011 | O Y Wong | S K Silverman | DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates. | 21510668 | 10.1021/bi200585n | Covalent Modification of Amino Acid Side Chains |