DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
Covalent Modification of Amino Acid Side Chains Group 1 - Tyr

Group 2 - 5'-triphosphate

L: GGATAATACGACTCACTATX
R: GGAAGAGAUGGCGACGG
X: HEG-Cys-Tyr-Ala
nucleopeptide linkage Mn2+
Mg2+
Tyr-RNA N 60
 Buffer conditions
50 mM HEPES pH 7.5, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl, 2 mM KCl
 Catalytic region of the DNAzyme
CAAGGAGAGTTGTACAAGCTCGGGTCGTGTTCAAAGGGATCATAGTGAGTAGACGATTT

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2012 T E Velez S K Silverman Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length. 23088677 10.1021/co300111f Covalent Modification of Amino Acid Side Chains

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra