| Reaction | Substrates | Product | Metal ion | Linkage | Seq description | DNA cleavage |
S: GGATAATACGACTCACTATCGGAAGAGATGGCGACTTCG |
hydrolyzed DNA |
Zn2+ |
DNA phosphodiester | N 20 |
|---|
| Buffer conditions |
|---|
| 70 mM HEPES pH 7.5, 1 mM ZnCl2, 150 mM NaCl |
| Yield (%) | kcat/ kobs |
|---|---|
| 40-50 | kobs = 0.053 h-1 |
| Catalytic region of the DNAzyme |
|---|
| CAGGATAATGGCGGTTTGGT |
| Notes |
|---|
| Hydrolysis site TATC^GGAA, phosphate after hydrolysis on 5' |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2012 | T E Velez | S K Silverman | Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length. | 23088677 | 10.1021/co300111f | DNA cleavage |