DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Substrates Product  Metal ion Linkage  Seq description
DNA cleavage S: GGATAATACGACTCACTATCGGAAGAGATGGCGACTTCG
hydrolyzed DNA Zn2+
DNA phosphodiester N 20
 Buffer conditions
70 mM HEPES pH 7.5, 1 mM ZnCl2, 150 mM NaCl
 Yield (%) kcat/ kobs
40-50 kobs = 0.053 h-1
 Catalytic region of the DNAzyme
CAGGATAATGGCGGTTTGGT
Notes
Hydrolysis site TATC^GGAA, phosphate after hydrolysis on 5'

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2012 T E Velez S K Silverman Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length. 23088677 10.1021/co300111f DNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra