| Reaction | Substrates | Product | Metal ion | Seq description | DNA cleavage |
S: TAATACGACTCACTATCGAAGAGATGGCGACGGA |
deglycosylated DNA |
Mn2+ Mg2+ Zn2+ |
N 20 |
|---|
| Buffer conditions |
|---|
| 70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
| Yield (%) | kcat/ kobs |
|---|---|
| 35-45 | kobs = 0.15 h-1 |
| Catalytic region of the DNAzyme |
|---|
| TTAGGGAGGGCCACCAGCTT |
| Notes |
|---|
| Consult reference to see deglycosylation site |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2012 | T E Velez | S K Silverman | Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length. | 23088677 | 10.1021/co300111f | DNA cleavage |