Reaction | Substrates | Product | Metal ion | Seq description | DNA cleavage |
S: TAATACGACTCACTATCGAAGAGATGGCGACGGA |
deglycosylated DNA |
Mn2+ Mg2+ Zn2+ |
N 20 |
---|
Buffer conditions |
---|
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
Yield (%) | kcat/ kobs |
---|---|
50-60 | kobs = 0.051 h-1 |
Catalytic region of the DNAzyme |
---|
AGGGGCGTGAGGGGTTCTTC |
Notes |
---|
Consult reference to see deglycosylation site |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2012 | T E Velez | S K Silverman | Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length. | 23088677 | 10.1021/co300111f | DNA cleavage |