Reaction | Reacting groups | Substrates | Product | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH Group 2 - vicinal phosphate |
S: *cleavage in cis, look up reference |
cleavage of single internal ribonucleotide phosphodiester | RNA phosphodiester | N 40 |
---|
Buffer conditions |
---|
1 M NaCI, 50 mM HEPES pH 7.0 |
Catalytic region of the DNAzyme |
---|
CCTGCTTCTCCGGTTCGTTACCGACATCATTCATT |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
1997 | C R Geyer | D Sen | Evidence for the metal-cofactor independence of an RNA phosphodiester-cleaving DNA enzyme. | 9281526 | 10.1016/s1074-5521(97)90244-1 | RNA cleavage |