DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product Linkage  Seq description
RNA cleavage Group 1 - 2'-OH

Group 2 - vicinal phosphate

S: *cleavage in cis, look up reference
cleavage of single internal ribonucleotide phosphodiester RNA phosphodiester N 40
 Buffer conditions
1 M NaCI, 50 mM HEPES pH 7.0
 Catalytic region of the DNAzyme
TTTACCCAAGAAGGGGTGGCATGAGCGCTACCCAGCACA

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
1997 C R Geyer D Sen Evidence for the metal-cofactor independence of an RNA phosphodiester-cleaving DNA enzyme. 9281526 10.1016/s1074-5521(97)90244-1 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra