Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: ACTCACTATrAGGAAGAGATG |
specific cleavage at desired position |
Zn2+ |
RNA phosphodiester | N 40 |
---|
Buffer conditions |
---|
1 mM ZnCl2, 500 mM NaCl and 50 mM HEPES pH 7.0 |
Catalytic region of the DNAzyme |
---|
GTCTCCGAGCCGGTCGAAATAGTCAGGTGTTTCTATTCGG |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2000 | J Li | Y Lu | In vitro selection and characterization of a highly efficient Zn(II)-dependent RNA-cleaving deoxyribozyme. | 10606646 | 10.1093/nar/28.2.481 | RNA cleavage |