Reaction | Reacting groups | Substrates | Product | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: GGGACGAATTCTAATACGACTCACTATrAGGAGCTCAGCCTTCACTGC |
specific cleavage at desired position | RNA phosphodiester | N 74 |
---|
Buffer conditions |
---|
20 mM Histidine, 125 mM NaCl, 125 mM KCl, 50 mM Na2HPO4/NaH2PO4 pH 7.0, 20 µM EDTA |
Catalytic region of the DNAzyme |
---|
TGCCGTGGGCAGCGGACGTTACCCAAGAAGGTGTGGGACGACACTATACCATATAGAATACCGCTTGCCGT |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
1997 | D Faulhammer | M Famulok | Characterization and divalent metal-ion dependence of in vitro selected deoxyribozymes which cleave DNA/RNA chimeric oligonucleotides. | 9191064 | 10.1006/jmbi.1997.1036 | RNA cleavage |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
1996 | D Faulhammer | M Famulok | The Ca2+ Ion as a Cofactor for a Novel RNA‐Cleaving Deoxyribozyme | None | 10.1002/anie.199628371 |
RNA cleavage |