DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: GGGACGAATTCTAATACGACTCACTATrAGGAGCTCAGCCTTCACTGC
specific cleavage at desired position Mg2+
RNA phosphodiester N 74
 Buffer conditions
20 mM Histidine, 125 mM NaCl, 125 mM KCl, 50 mM Na2HPO4/NaH2PO4 pH 7.0, 0.5 mM MgCl2, 20 µM EDTA
 Catalytic region of the DNAzyme
AAGCTCTCTCAGCGAGACGAAATAGGGAGTTAGCAGCACGAGGTTACACTTTTATCCTCTCCCAAAGTAGGGAC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
1996 D Faulhammer M Famulok The Ca2+ Ion as a Cofactor for a Novel RNA‐Cleaving Deoxyribozyme None 10.1002/anie.199628371 RNA cleavage

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
1997 D Faulhammer M Famulok Characterization and divalent metal-ion dependence of in vitro selected deoxyribozymes which cleave DNA/RNA chimeric oligonucleotides. 9191064 10.1006/jmbi.1997.1036 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra