DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: TCACTATrAGGAAGAGATG
specific cleavage at desired position Mg2+
RNA phosphodiester N 40
 Buffer conditions
1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2
 Catalytic region of the DNAzyme
ATCAGCGATCCACGCTTATTTAAACGTGGCACCCATGTTA
Notes
Evolved from E0

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
1995 R R Breaker G F Joyce A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity. 9383471 10.1016/1074-5521(95)90028-4 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra