Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: TCACTATrAGGAAGAG |
specific cleavage at desired position |
Mg2+ |
RNA phosphodiester | N 40 |
---|
Buffer conditions |
---|
1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2 |
Catalytic region of the DNAzyme |
---|
TTCAGCGATTAACGGAACGTTACACCCATGTTA |
Notes |
---|
Truncated version of E2 |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
1995 | R R Breaker | G F Joyce | A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity. | 9383471 | 10.1016/1074-5521(95)90028-4 | RNA cleavage |