| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: GGGACGAATTCTAATACGACTCACTATrAGGAAGAGATGGCGAC |
specific cleavage at desired position, likely resulting in 5' product with a terminal 2',3'-cyclic phosphate, and a 3' product with a 5'-OH |
Pb2+ |
RNA phosphodiester | N 50 |
|---|
| Buffer conditions |
|---|
| 0.5 M NaCl, 0.5 M KCl, 50 mM MgCl2, 50 mM HEPES pH 7.0, 1 mM PbOAc |
| Catalytic region of the DNAzyme |
|---|
| GCCAGATTGCTGCTACCAGCGGTACGAAATAGTGAAGTGTTCGTGACTAT |
| Notes |
|---|
| Cleave at single ribont embedded in the otherwise all-DNA substrate, name given by me in order to differentiate from other clones reported in the paper |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 1994 | R R Breaker | G F Joyce | A DNA enzyme that cleaves RNA. | 9383394 | 10.1016/1074-5521(94)90014-0 | RNA cleavage |