DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - internal 2'-OH

Group 2 - 5'-triphosphate

L: GGAUAAUACGUCUCAC
R: GGAAGAGAUGGCGACGG
branched RNA Mg2+
A8 N *
 Buffer conditions
50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2
 Yield (%) kcat/ kobs
90 kobs = 0.19 min-1
 Catalytic region of the DNAzyme
AGTGTGCTGCTAGGGCGTGAGGGTCCGCTTCC
Notes
Pool N15-GTGAG-N7

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2006 E Zelin Scott K Silverman Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing. 16503631 10.1021/bi052499l RNA ligation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra