| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA ligation |
Group 1 - internal 2'-OH Group 2 - 5'-triphosphate |
L: GGAUAAUACGUCUCAC R: GGAAGAGAUGGCGACGG |
branched RNA |
Mg2+ |
A8 | N * |
|---|
| Buffer conditions |
|---|
| 50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2 |
| Yield (%) | kcat/ kobs |
|---|---|
| >85 | kobs = 0.26 min-1 |
| Catalytic region of the DNAzyme |
|---|
| CCGTAGGTGAAGGGCGTGAGGGTTCCATTCC |
| Notes |
|---|
| Pool N15-GTGAG-N7 |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2006 | E Zelin | Scott K Silverman | Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing. | 16503631 | 10.1021/bi052499l | RNA ligation |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2007 | C Höbartner | S K Silverman | Engineering a selective small-molecule substrate binding site into a deoxyribozyme. | 17694519 | 10.1002/anie.200702217 |
RNA ligation |