DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
DNA ligation Group 1 - internal 2'-OH

Group 2 - 5'-adenylate

L: TAATACGrACTCACTATA
R: GGAAGAGATGGCGACGG
branched DNA Mg2+
A8 N *
 Buffer conditions
50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2
 Yield (%) kcat/ kobs
>90 kobs = 0.056 h-1 for branch-site nucleotide rU
 Catalytic region of the DNAzyme
CCGGCCACGGCGTCAGTGAGGCAAGACTTCC
Notes
Pool N15-GTGAG-N7

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2008 T P Mui S K Silverman Convergent and general one-step DNA-catalyzed synthesis of multiply branched DNA. 18808125 10.1021/ol801568q DNA ligation

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2011 C S Lee S K Silverman Improved deoxyribozymes for synthesis of covalently branched DNA and RNA. 20739352 10.1093/nar/gkq753 RNA ligation
DNA ligation
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra