Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | DNA ligation |
Group 1 - internal 2'-OH Group 2 - 5'-adenylate |
L: TAATACGrACTCACTATA R: GGAAGAGATGGCGACGG |
branched DNA |
Mg2+ |
A8 | N * |
---|
Buffer conditions |
---|
50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2 |
Yield (%) | kcat/ kobs |
---|---|
>90 | kobs = 0.056 h-1 for branch-site nucleotide rU |
Catalytic region of the DNAzyme |
---|
CCGGCCACGGCGTCAGTGAGGCAAGACTTCC |
Notes |
---|
Pool N15-GTGAG-N7 |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2008 | T P Mui | S K Silverman | Convergent and general one-step DNA-catalyzed synthesis of multiply branched DNA. | 18808125 | 10.1021/ol801568q | DNA ligation |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2011 | C S Lee | S K Silverman | Improved deoxyribozymes for synthesis of covalently branched DNA and RNA. | 20739352 | 10.1093/nar/gkq753 |
RNA ligation DNA ligation |