DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - 2',3'-diol

Group 2 - 5'-triphosphate

L: d(GAACTGACGAACTGATGCTCAC)-r(UAUA)
R: GAGACCGUAAUGAGUAG
non-native RNA Mg2+
2',5' N *
 Buffer conditions
25 mM MgCl2, 25 mM EPPS pH 8.5
 Catalytic region of the DNAzyme
CTAACCATTATCCTCGATTGTTAGAACGAACAGTTGCAACGGGTTGATTATAGTGGG
Notes
Evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2006 N Paul G F Joyce Conversion of a ribozyme to a deoxyribozyme through in vitro evolution. 16638538 10.1016/j.chembiol.2006.01.007 RNA ligation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra