DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - internal 2'-OH

Group 2 - 5'-triphosphate

L: GGAAGUCUCAUGUACUAUCG
R: GAAUGUUCUAGCGCGGA
branched RNA Mn2+
U16 N 20
 Buffer conditions
50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2
 Yield (%) kcat/ kobs
90 kobs = 0.67 h-1
 Catalytic region of the DNAzyme
GGCACTCAGAGCGCACGGCG

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2005 E D Pratico S K Silverman A deoxyribozyme that synthesizes 2',5'-branched RNA with any branch-site nucleotide. 15967808 10.1093/nar/gki656 RNA ligation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra