DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - 2',3'-cyclic phosphate

Group 2 - 5'-OH

L: UAAUACGACUCACUAUA
R: GGAAGAGAUGGCGACGG
unnatural Zn2+
* N 40
 Buffer conditions
70 mM Tris pH 7.9, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2
 Yield (%) kcat/ kobs
45 kobs = 0.061 min-1
 Catalytic region of the DNAzyme
CGGGAGAGGAGTGGCAGAGATACTGTGAATGTAATCTGAG
Notes
Same as 6J12

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2005 K A Hoadley S K Silverman Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages. 15966746 10.1021/bi050146g RNA ligation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra