| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA ligation | 
        Group 1 - 2',3'-cyclic phosphate Group 2 - 5'-OH  | 
      
      
      
       L: UAAUACGACUCACUAUA R: GGAAGAGAUGGCGACGG  | 
      
      
      unnatural | 
        
          Zn2+ | 
      
      
      * | N 40 | 
|---|
| Buffer conditions | 
|---|
| 70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2 | 
| Yield (%) | kcat/ kobs | 
|---|---|
| Approx. 35 for R substrates with 5'-dG and G. | kobs = 0.0107/0.056 min-1 for R substrates with 5'-dG and G, respectively. | 
| Catalytic region of the DNAzyme | 
|---|
| CACGCTGACTAGCTTCGTGAGGGGGTGTGATAGATGCGG | 
| Notes | 
|---|
| 2',3'-branch or 2',2'-branch | 
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction | 
|---|---|---|---|---|---|---|
| 2005 | K A Hoadley | S K Silverman | Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages. | 15966746 | 10.1021/bi050146g | RNA ligation | 
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction | 
|---|---|---|---|---|---|---|
| 2008 | D M Kost | S K Silverman | Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates. | 19005599 | 10.1039/B813566E | 
          
            
              RNA ligation |