Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA ligation |
Group 1 - 2',3'-cyclic phosphate Group 2 - 5'-OH |
L: UAAUACGACUCACUAUA R: GGAAGAGAUGGCGACGG |
native RNA |
Zn2+ |
3',5' | N 40 |
---|
Buffer conditions |
---|
70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2 |
Yield (%) | kcat/ kobs |
---|---|
35/17 for R substrates with 5'-dG and G, respectively. | kobs = 0.020/0.013 min-1 for R substrates with 5'-dG and G, respectively. |
Catalytic region of the DNAzyme |
---|
CAGCGCGATTGAGTGCGTGATTGAAGCTCGGGGTTGGTTA |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2005 | K A Hoadley | S K Silverman | Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages. | 15966746 | 10.1021/bi050146g | RNA ligation |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2008 | D M Kost | S K Silverman | Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates. | 19005599 | 10.1039/B813566E |
RNA ligation |