DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - 2',3'-cyclic phosphate

Group 2 - 5'-OH

L: UAAUACGACUCACUAUA
R: GGAAGAGAUGGCGACGG
native RNA Zn2+
3',5' N 40
 Buffer conditions
70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2
 Catalytic region of the DNAzyme
GTGAGAGCAGGTTTGGCACGCGTGCCACTAACCCGCGCCT

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2008 D M Kost S K Silverman Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates. 19005599 10.1039/B813566E RNA ligation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra