DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - internal 2'-OH

Group 2 - 5'-triphosphate

L: UAAUACGACUCACUAUX
R: GGAAGAGAUGGCGACGG
X: A, C, dA, dC
branched RNA Mn2+
Mg2+
A15 N 40
 Buffer conditions
50 mM HEPES pH 7.5, 20 mM MnCl2
 Yield (%) kcat/ kobs
>85 kobs = 0.27 (min-1) at pH 7.5
 Catalytic region of the DNAzyme
AATGAGGCTTGGCAGGGATTTAGTATTTTAACACTCCCGG
Notes
LARIAT FORMATION

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2003 Y Wang S K Silverman Deoxyribozymes that synthesize branched and lariat RNA. 12783536 10.1021/ja035150z RNA ligation

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2003 Y Wang S K Silverman Characterization of deoxyribozymes that synthesize branched RNA. 14690435 10.1021/bi0355847 RNA ligation
2004 R L Coppins S K Silverman A DNA enzyme that mimics the first step of RNA splicing. 14758353 10.1038/nsmb727 RNA ligation
2013 F Javadi-Zarnaghi Lanthanide cofactors accelerate DNA-catalyzed synthesis of branched RNA. 23895365 10.1021/ja406162z RNA ligation
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra