Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA ligation |
Group 1 - 2',3'-cyclic phosphate Group 2 - 5'-OH |
L: UAAUACGACUCACUAUA R: GGAAGAGAUGGCGACGG |
non-native RNA |
Mg2+ |
2',5' | N 20 |
---|
Buffer conditions |
---|
50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40mM MgCl2 |
Yield (%) | kcat/ kobs |
---|---|
15 | kobs = 0.42 (h-1) |
Catalytic region of the DNAzyme |
---|
TTCGGTGGAGGTAAGCTCTG |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2003 | A Flynn-Charlebois | S K Silverman | In vitro evolution of an RNA-cleaving DNA enzyme into an RNA ligase switches the selectivity from 3'-5' to 2'-5'. | 12720447 | 10.1021/ja0340331 | RNA ligation |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2003 | B L Ricca | S K Silverman | Optimization and generality of a small deoxyribozyme that ligates RNA. | 12860124 | 10.1016/S0022-2836(03)00654-5 |
RNA ligation |