DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - 2',3 '- diol

Group 2 - 5'-triphosphate

L: GGAAGUCUCAUGUACUAUCG
R: GAAUGUUCUAGCGCGGA
native RNA Mn2+
3',5' N 40
 Buffer conditions
50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2
 Catalytic region of the DNAzyme
CCCGTGACATTCATATGGGGTCGGTTCCAATCGCGAATTA

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2005 Y Wang S K Silverman Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation. 15723545 10.1021/bi0478291 RNA ligation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra