DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 3'-OH of rA

Group 2 - vicinal phosphate

S: GTCACGAGTCACTATrAGGAAGATGGCGAAA
specific cleavage at desired position Ce3+
2'-5'-RNA linkage N 50
 Buffer conditions
50 mM MES pH 6.0, 50 mM KCl, 10 μM Ce3+
 kcat/ kobs
kobs = 0.16 min-1
 Catalytic region of the DNAzyme
TTTCGCCATCTTTAGGAATATCTATTCCACGGCTCACGAAATAGTGACTCGTGAC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2016 W Zhou J Liu An Efficient Lanthanide-Dependent DNAzyme Cleaving 2'-5'-Linked RNA. 26957420 10.1002/cbic.201500690 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra