| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: trans-cleaving |
specific cleavage at desired position |
Pb2+ |
RNA phosphodiester | N 35 |
|---|
| Buffer conditions |
|---|
| 60 µM Pb2+, 50 mM MES pH 6.0, 25 mM NaCl |
| Catalytic region of the DNAzyme |
|---|
| AGGGAAAGAAAAAGGCGGGGAAGTAACGAGA |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2015 | R Saran | J Liu | Searching for a DNAzyme Version of the Leadzyme. | 26458991 | 10.1007/s00239-015-9702-z | RNA cleavage |