| Reaction | Substrates | Product | Seq description | Porphyrin metalation |
S: mesoporphyrin IX (MPIX) |
Cu-MPIX | N 30 |
|---|
| Catalytic region of the DNAzyme |
|---|
| AGCCCTGCTGCATTGCAACCAGGGGGTGGGCGTACCAGCAGGGCT |
| Notes |
|---|
| Selected as aptamers for NMM, can catalyze the insertion of several divalent metal ions into MPIX. Nm2-hemin complex displayed a DNA-enhanced peroxidase activity with the substrate of ABTS. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2019 | L Yang | R Pei | Exploration of Catalytic Nucleic Acids on Porphyrin Metalation and Peroxidase Activity by in Vitro Selection of Aptamers for N-Methyl Mesoporphyrin IX. | 30602113 | 10.1021/acscombsci.8b00129 | Porphyrin metalation |