Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|---|
RNA cleavage |
Group 1 - 2'-OH of rU Group 2 - vicinal phosphate |
S: cleavage in cis |
cleavage after either position 2 or 6 in the all-RNA substrate, both being UA junctions. |
M2+-independent |
RNA phosphodiester | N 50 |
Buffer conditions |
---|
0.2 M NaCl, 10 mM EDTA, 50 mM Tris–HCl pH 7.5 |
kcat/ kobs |
---|
kobs = 0.07 min-1 |
Catalytic region of the DNAzyme |
---|
CCATTCTCCTCTGCTGGACTATTCGGGTCTTTGTTCTCTCATGGTTGTGT |
Notes |
---|
C5-imidazolyl-modified dUTP and 3-(aminopropynyl)-7-deaza-dATP were used during the selection, incorporating in this way two protein-like functionalities, namely, imidazolyl (histidine analogue) and primary amino (lysine analogue) into the DNAzymes. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2004 | A V Sidorov | D M Williams | Sequence-specific cleavage of RNA in the absence of divalent metal ions by a DNAzyme incorporating imidazolyl and amino functionalities. | 15004246 | 10.1093/nar/gkh326 | RNA cleavage |