DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rC

Group 2 - vicinal phosphate

S: GATGTGTCCGTGCTrCTGGTTCGATTTGTTT
specific cleavage at desired position Mn2+
Mg2+
RNA phosphodiester N 40
 Buffer conditions
100 mM KCl, 400 mM NaCl, 50 mM Hepes pH 7.0 at 23 °C, 7.5 mM MgCl2, 7.5 mM MnCl2
 Yield (%) kcat/ kobs
60 kobs = 0.34 min-1*
 Catalytic region of the DNAzyme
CAAATTGATCGGTGGGGAGCAACTGAAAGGCGGTTGCAATGCGGATGGATGGTACGGTC
Notes
Made to act in trans from CT10-3.29. Extensive structure probing data. Mutants of this DNAzyme achieve greater cleavage rates and higher yields, i.e. CT10.3.29M1 has k<sub>obs</sub> = 1.4 min<sup>-1</sup>.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2010 J C F Lam Y Li A complex RNA-cleaving DNAzyme that can efficiently cleave a pyrimidine-pyrimidine junction. 20630470 10.1016/j.jmb.2010.05.047 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra