| Reaction | Reacting groups | Substrates | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: cleavage in cis |
metal ion dependency not reported |
RNA phosphodiester | N 40 |
|---|
| Buffer conditions |
|---|
| 50 mM Na.Hepes pH 7.0, 0.5 M NaCl, 10 mM Mg2+ |
| kcat/ kobs |
|---|
| kobs = 0.44 min-1 |
| Catalytic region of the DNAzyme |
|---|
| GCTCTTAGGAGGTAGGGGTTCCGATCCAGGTGGCTGGGTA |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2001 | A R Feldman | D Sen | A new and efficient DNA enzyme for the sequence-specific cleavage of RNA. | 11800557 | 10.1006/jmbi.2001.5058 | RNA cleavage |