DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: cleavage in cis
metal ion dependency not reported
RNA phosphodiester N 40
 Buffer conditions
50 mM Na.Hepes pH 7.0, 0.5 M NaCl, 10 mM Mg2+
 Catalytic region of the DNAzyme
TCCAAAGATCGAGGTAGGGGTTCCGAACCAGGTGGCGTGC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2001 A R Feldman D Sen A new and efficient DNA enzyme for the sequence-specific cleavage of RNA. 11800557 10.1006/jmbi.2001.5058 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra