DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rC

Group 2 - vicinal phosphate

S: GAGAGAGATrCCGTGCGTTAC
cleavage at CC junction Mn2+
RNA phosphodiester N 20
 Buffer conditions
100 mM KCl, 400 mM NaCl, 7.5 mM MgCl2 , 7.5 mM MnCl2, 50 mM HEPES pH 7.0
 Yield (%) kcat/ kobs
90 kobs = 0.12 min-1
 Catalytic region of the DNAzyme
TACTGCTTTACTGGCGGCCA

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2008 K Schlosser Y Li In vitro selection of small RNA-cleaving deoxyribozymes that cleave pyrimidine-pyrimidine junctions. 18644842 10.1093/nar/gkn396 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra