Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: GAGAGAGATrACGTGCGTTAC |
cleavage at AC junction |
Mn2+ |
RNA phosphodiester | N 20 |
---|
Buffer conditions |
---|
100 mM KCl, 400 mM NaCl, 7.5 mM MgCl2 , 7.5 mM MnCl2, 50 mM HEPES pH 7.0 |
Yield (%) | kcat/ kobs |
---|---|
75 | kobs = 0.03 min-1 |
Catalytic region of the DNAzyme |
---|
AAATCCAGGGTTGGCCGACA |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2008 | K Schlosser | Y Li | In vitro selection of small RNA-cleaving deoxyribozymes that cleave pyrimidine-pyrimidine junctions. | 18644842 | 10.1093/nar/gkn396 | RNA cleavage |