| Reaction | Substrates | Product | Metal ion | Seq description | DNA cleavage |
S: GCCGATCCATACTGCGGAACACT |
specifically at the desired thymidine |
Mn2+ Cu2+ |
N 40 |
|---|
| Buffer conditions |
|---|
| 50 mM HEPES pH 7.4, 400 mM NaCl, 100 mM KCl, 10 mM MgCl2, 7.5 mM MnCl2, 50 μM CuCl2 |
| Yield (%) | kcat/ kobs |
|---|---|
| 84 | kobs = 0.137 h-1 |
| Catalytic region of the DNAzyme |
|---|
| AGTGTTCCGTGGATGGAGCAATAGTCTCCCGGGTCCGTATGGATCGGCA |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2014 | M Wang | Z Tang | In vitro selection of DNA-cleaving deoxyribozyme with site-specific thymidine excision activity. | 25030901 | 10.1093/nar/gku592 | DNA cleavage |