Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|---|
RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
Co2+ |
RNA phosphodiester | N 40 |
Buffer conditions |
---|
50 mM HEPES pH 7.0, 500 mM NaCl, 1 mM CoCl2 |
kcat/ kobs |
---|
kobs = 0.175 min-1 |
Catalytic region of the DNAzyme |
---|
TTGTATTAGCTACACTGTTAGTGCATCGTTTTTAATCTCG |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2002 | P J Bruesehoff | Y Lu | Improving metal ion specificity during in vitro selection of catalytic DNA. | 12052183 | 10.2174/1386207023330264 | RNA cleavage |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2012 | K E Nelson | Y Lu | The importance of peripheral sequences in determining the metal selectivity of an in vitro-selected Co(2+) -dependent DNAzyme. | 22250000 | 10.1002/cbic.201100724 |
RNA cleavage |