| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
Co2+ |
RNA phosphodiester | N 40 |
|---|
| Buffer conditions |
|---|
| 50 mM HEPES pH 7.0, 500 mM NaCl, 1 mM CoCl2 |
| kcat/ kobs |
|---|
| kobs = 0.175 min-1 |
| Catalytic region of the DNAzyme |
|---|
| TTGTATTAGCTACACTGTTAGTGCATCGTTTTTAATCTCG |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2002 | P J Bruesehoff | Y Lu | Improving metal ion specificity during in vitro selection of catalytic DNA. | 12052183 | 10.2174/1386207023330264 | RNA cleavage |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2012 | K E Nelson | Y Lu | The importance of peripheral sequences in determining the metal selectivity of an in vitro-selected Co(2+) -dependent DNAzyme. | 22250000 | 10.1002/cbic.201100724 |
RNA cleavage |